Slave mentality
Whenever I write anything criticizing the Chinese government I get a scattering of e-mails like this one from people with Chinese surnames. The forenames are invariably male.
Mr Derbyshire — The fireworks 'fakery' [i.e. at the Olympics opening ceremony, which I had written about] was nothing. The fireworks were there but they found it difficult to film. No different from the arrow which lit the torch at Athens. Whats more the Chinese did not try to hide this at all — nor did they hide the lip synching. Contrast this with the Australians had their orchestra mime their performance at Sydney. Whats more they gagged the performers — making them sign a confidentiality agreement.
All this nit-picking is just resentful westerners bitter at the rise of a non-white nation. But at least the Western media beatup awakens more Chinese people to the hatred that exists for them in the West.
The fact is the Chinese goverment is more popular than ever before, as a recent Pew research poll has shown. This matches my personal experience.
In fact most Chinese I know, even those in Hong Kong where I live, were angry with the government for not coming down more harshly with the Tibetans.
And the Olympic games, I would wager were the most popularly supported of all time.
My reactions to these sneering little epistles are multifold.
If the ChiComs are so darn popular, why don’t they confirm their popularity by holding an election, as governments do in other modern nations? That would kill once and for all the annoying Western carping about legitimacy. If Chinese people want to live down the old “slave mentality” canard, a good start would be to stop expressing satisfaction with leaders who have elected themselves. Citizens of free nations prefer to have some say in the matter. I don’t know of any Westerner who is “bitter at the rise of a non-white nation.” I don’t, for example, recall a single instance of anyone expressing bitterness to me at the rise of India, Malaysia, or Taiwan. I do, though, know quite a lot of people who worry about the rise of a bloodstained dictatorship, many of whose young males express the aggrieved racial resentment of correspondents like that one, and their obvious, fascistic admiration for unrestrained despotic power.
This month's most defiantly moronic assertion of blank slate orthodoxy
“I believe that given the opportunity, most people could do most anything.” — New York Times reporter Deborah Solomon, interviewing Charles Murray about his new book Real Education.
Silly-clever
I mentioned in “The Corner" that I have been reading books of religious — so far, only Christian — apologetics. That brought in more e-mail than the average ten comments about politics. Yes, my purpose here is subversive. I have the vague idea of writing a sort of vade mecum for the conservative unbeliever. “Why should the Devil have all the best tunes?” asked William Booth. Well, why should the Left have all the good hearty atheist manifestos? American liberalism and American conservatism have both in turn been debauched by presidents filled with religious zeal (J. Carter and G. W. Bush respectively). Perhaps atheism may yet be the salvation of the Republic.
Far and away the most enjoyable — since I am at odds with the subject matter, I suppose in honesty I should say “least unenjoyable” — apologetic I have read so far is Paul Johnson’s. I am tempted to say that any believers out there who feel like writing a book of apologetics should imitate P.J.’s approach, if they want to make any impression on the unbelieving reader. (Which I suspect very few of them actually do want to do …)
There is no point in saying this though, because to follow in P.J.’s footsteps, you’d need to have a mind as well furnished as his; and very, very few of us have that. The joy of reading P.J. is the odd little factlets he throws out on every page from his capacious and densely stocked memory. Did you know that the Duke of Wellington’s funeral carriage “was of cast-iron, weighed 20 tons and can still be seen in the crypt of St. Paul’s cathedral”? Or that “After the Book of Job, [God] scarcely speaks ever again … He becomes a silent God.” Or that there was a fashion among English artists of the eleventh century to portray the Ascension with only the legs and feet of Christ showing, the rest of him having disappeared into the cloud (Acts 1.ix)?
So did P.J. come close to converting me? Good grief, no. He left me feeling sad, in fact, that so much erudition and brilliance should have put itself in service to such rank superstition. There is nothing indirect or hesitant about P.J.’s Christianity, no wishy-washy kind’n’gentle hell-is-empty equivocation. This is pure Baltimore Catechism fire and brimstone. P.J.’s hell is real, painful, and most likely (he leaves himself an out here, but it looks like a perfunctory afterthought) well-populated. I'm headed there myself, according to P.J.:
To become Hell-fodder, a soul must have a pronounced and ineradicable streak of arrogance …
Oh dear. P.J. softens a little when writing of St. Thomas Aquinas’s much-derided suggestion in Summa Theologica that one of the pleasures of Heaven is watching the damned suffer in Hell: “… as if happy souls parade on a sort of celestial balcony to watch the devils prodding and incinerating the damned down below.” It’s all much more subtle than that, says P.J. Is it? I must say, if I could bring myself to believe in any of this afterlife business, the prospect of making it to that balcony would be exactly the thing to get me down on my knees praying to be saved.
P.J. has the eschaton figured out in fine detail:
Judgment Day is quite a complicated affair. Correction: it is an infinitely complicated affair, involving literally billions of people. In addition to the masses of souls involved, there is the added complication that they are divided into two main groups, each subdivided into three. The two main groups are those who have already been dealt with at their Particular Judgments, spread over thousands of years … and those still on earth when it comes to an end, whose Particular Judgment is telescoped into the General Judgment …
It sounds worse than the lifeboat drill they put you through at the start of a cruise. “If you have a green tag, you want to be over at the other side of the ship …” One thing you have to concede to atheists: our afterlife is a whole lot simpler. As an unbeliever friend of mine likes to say: “Things get real quiet.”
For an unbeliever, though, most apologetics is thin and dreary stuff. Thinnest and dreariest of all so far was the book all my Christian friends told me I must read, C.S. Lewis’s Mere Christianity. Do people really take Lewis seriously on religion? He had a superb imaginative gift — the Narnia books are delightful, except the last, which I thought over the top, and which baffled my kids when I read it to them. People who know these things tell me Lewis was a first-class literary critic, too. In fact, with the Milton quadricentenary coming up, a friend tells me that Lewis’s book on Milton is a classic, a must-read. (I have so far got no further in paying my respects to the great poet than listening to Prof. Lerer’s Teaching Company lectures.)
I can’t speak to Lewis’s literary criticism, but having now sampled both his fantasy fiction and his apologetics, I’d have to say that there strikes me as something disconcertingly childlike about the man, some way in which he never grew up. This particular human defect is just what you want in a writer of fantasy, of course — the other Lewis (Carroll) being the star exhibit here. It is fatal to anyone writing about religion, though, as the childlike side of religious belief — the wishful thinking, the misplaced logic, the unworldliness — is exactly what a writer of apologetics should steer away from if he wants to appeal to adults.
In Lewis’s case the result is particularly unappetizing, threadbare, and paltry arguments delivered in a tone that is irritating beyond endurance. Just compare Lewis on sex (Chapter III.5) with P.J. (Chapter 5). Lewis: “I know some muddle-headed Christians have talked as if Christianity thought that sex, or the body, or pleasure, were bad in themselves. But they were wrong. Christianity is almost the only one of the great religions which thoroughly approves of the body …” (There are certain Hindu temples I should like to have taken Lewis to see.) P.J.: “Sex among human beings is … a rival to God, often a successful rival. The church is sensible to take it with the utmost seriousness.” Nothing “muddle-headed” about P.J.’s faith.
I’m glad to see myself in good company here. In his “As I Please” column for October 27, 1944, George Orwell wrote about Lewis’s book Beyond Personality, which ended up as Book IV of Mere Christianity. Orwell couldn’t stand Lewis’s gay-scoutmaster style either. This was in fact the occasion of Orwell’s blast at what he called the “silly-clever" type of religious apologetics:
A kind of book that has been endemic in England for quite sixty years is the silly-clever religious book, which goes on the principle not of threatening the unbeliever with Hell, but of showing him up as an illogical ass, incapable of clear thought and unaware that everything he says has been said and refuted before … The line of attack is always the same. Every heresy has been uttered before (with the implication that it has also been refuted before); and theology is only understood by theologians (with the implication that you should leave your thinking to the priests). Along these lines one can, of course, have a lot of clean fun by "correcting loose thinking" and pointing out that so-and-so is only saying what Pelagius said in a d 400 (or whenever it was), and has in any case used the word transsubstantiation in the wrong sense …
Footnote to all that: I note that P.J. and Orwell both capitalize “Hell.” WFB did too; there is a witty aside about that in Nearer My God. Yet Milton, whom I mentioned up above there somewhere, doesn’t, not at any rate in the Cambridge University Press edition of Paradise Lost, which I have always supposed to be definitive.
Say first, for heaven hides nothing from thy view
Nor the deep tract of hell, say first what cause
Move our grand parents in that happy state,
Favoured of heaven so highly, to fall off
From their Creator …
Shouldn’t Milton be the ultimate authority here? If he didn’t capitalize “Hell,” why should I? (“Usually lowercased” says The New York Public Library Writer’s Guide to Style and Usage … but everyone goes by that damn Chicago thing that I don't have. Who cares about bloody Chicago?)
I’ve gone on too long about this, haven’t I? I'll stop.
Harris on Palin
Actually, I’ll segue off that to Celebrity Atheist Sam Harris's attack on Sarah Palin in the September 20 issue of Newsweek. Sam objects to Sarah’s religious views of course, but it was this other point that got my attention:
The next administration must immediately confront issues like nuclear proliferation, ongoing wars in Iraq and Afghanistan (and covert wars elsewhere), global climate change, a convulsing economy, Russian belligerence, the rise of China, emerging epidemics, Islamism on a hundred fronts, a defunct United Nations, the deterioration of American schools, failures of energy, infrastructure and Internet security … the list is long, and Sarah Palin does not seem competent even to rank these items in order of importance, much less address any one of them.
That is elitism run amok. Who on earth has the expertise to cope knowledgeably with all those issues? Even to reach Sam’s standard, you could put together a roomful of the smartest people in the U.S.A., and I doubt they'd agree on an importance ranking.
We’re not electing a philosopher-king, we’re electing an administrator, someone with good common sense and sound judgment. We’ve tried Wonder Boys in the presidency, and they didn’t work out too well. Herbert Hoover, anybody? (With Paul Johnson still in mind, recall how in Modern Times he tagged Hoover with Tacitus’s verdict on the emperor Galba: omnium consensu capax imperii nisi imperasset — "by general consent fit to rule, had he not ruled.”) Or how about Jimmy Carter, an exceptionally clever, capable, and accomplished man? On the other side there is Harry Truman, who was scoffed at in much the sames terms Harris uses against Palin.
The question who will, and who will not, make a good president is more mysterious than the disposition of souls in the afterlife. The poor voter can do little better than go with the candidate whose broad outlook on public affairs matches his own. As to intelligence, education, and ability — well, so long as my candidate, thus selected, doesn’t actually drool or fall down in public, I’ll rest my hopes in him/her doing at least better than Hoover and Carter, perhaps even as well as Truman. (Who, by the way, was my father’s favorite U.S. president, for reasons I have forgotten.)
And the real lesson here is surely a conservative one: Since, given the number and scale of the issues they face, it is not likely that much of what they do will be right, the less we allow them to do, the better. Left alone, most problems take care of themselves.
Charles Hurt, writing in America’s Newspaper of Record on September 29, struck a chord that should resonate in the breast of every true conservative:
The reason Americans endure their federal government is that it is so inept and useless that it has little bearing on their everyday lives. But in an economic meltdown like this, people don't have a choice but to feel the fallout of their government's incompetence …
Exactly. Washington, D.C., is populated by fools and rogues. The less power we give them, the better. Yet we keep on giving them more! Perhaps we are fools, too.
Mind science book of the month
Still chewing my way through a long booklist I assembled after that mind-science conference I blogged on back in April. This month I read a gem: Jeff Hawkins’s 2004 book On Intelligence, which is nothing to do with IQ, but offers a good practical model of how the brain works. I’ve read bits and pieces of this in other books and science-mag articles, but Hawkins, who is founder of the Redwood Neuroscience Institute as well as a successful computing entrepreneur, puts it altogether very cogently.
Sexiest voice
Well, who’s got it? The sexiest singing voice, that is. Trying this question out on friends I got some unexpected answers: Edith Piaf (come on: if she had sung in English, would you have thought her sexy?); Emmylou Harris (way easy on the eye back in her prime, I'll agree, but the voice? hmmm); Julie London (from Mike Potemra, that, and a penetrating suggestion — gonna have to consider it); Rod Stewart (for goodness sake!) …
Well, here’s my vote: Doris Day. Off the wall, I know; but here’s how I go to thinking about it. In the September issue of Literary Review, Christopher Bray reviews two recent biographies of Ms. Day (originally Doris Kappelhoff, and still with us, aged 86). Bray’s review includes the following:
[W]hat marked her out, as her talent grew, was the orgasmic tremor that fired her long, glowing phrases. She could bend every note till it was hangdog with heartache, but she never sounded sorry for herself. Listen again to "Secret Love" from Calamity Jane, to the title song of Move Over, Darling, or to anything from Duet (the piano and voice album she made with André Previn in the early Sixties), and try gainsaying [bandleader Les] Brown's claim that "next to Sinatra, Doris is the best in the business on selling a lyric"
I'll go along with that, if only because, ever since reading the review, those first two songs have been playing in my head on permanent loops. Does anyone know how to switch these things off?
World's most out-of-print book?
In conversation with some friends I mentioned Peter Kemp, the young Englishman who went off to fight for Franco in the Spanish Civil War and wrote a fine book about the experience, title Mine Were of Trouble. In spite of being badly wounded in Spain — half his jaw was blown off by a hand grenade; his comrades anesthetized him with brandy — Kemp went on to be a war lover, seeking out danger anywhere he could find it.
This remarkable man seems to have sunk without trace. So has his book. I read it 20 years ago, but in a library copy. Thinking I’d like to read it again, I went to Abebooks.com, which has everything. The only copy of Mine Were of Trouble on Abebooks was a Spanish translation. Kemp gets a passing mention in A.N. Wilson’s After the Victorians, but has otherwise disappeared down the memory hole. What a pity. He was not, by the way, a fascist. In his book he described himself as a “royalist” and the forces he was fighting with as “Carlists.” He fought bravely on the Allied side in WW2. Later he fought with the French against the Vietminh. The man just liked fighting — a true war lover. Somehow he survived it all. Now he’s forgotten. What a pity.
Wonders of the Internet
I still, after all these years, occasionally get a say-what? moment when browsing the Internet. It happened the other day. I needed to look up something David Hume said, so I brought up gutenberg.org, went to “Authors,” clicked on “H,” and scanned down to the “Hu—”s. Whoa! “Human Genome Project”? Yep, there's the entire genetic code of a human being.
It sure makes compulsive reading. From Chromosome 17:
GAATTCTGGGAGATACAAGTCAAGTTGAGATTTCTGTGGGGACGCAGCCAAACCATATCA
CCTGGTTTCTCTGTGTTGCCCAGGCTAGTCTTGAACTCCTGGGCTCAAGCGATCTGCATG
CCTCGGTCCATCAAAATATTGGAATTACAGGCTTGAGCCACTGTGCCCGGCCTCTGCTGA
CCTTTTAAATAAAGCTTTGGCAAGTGACAGTTTGAGGTTAGGAACCATTGATAATTGATG
AATTACCGGATAAGTCTTTATTTCTTCCTTCTACATCTGATAATAAATCCGATGATTTCC
ATTTTCATGTCATTGCGCCTCTACTGTTAACATATAATTATTTATACTTTCTATTTTTTT
TTTTTTAACTCTTCCACTTTCTCTTTTTGTGGTGGGGTACTTACCCTAGCAATAAACACA …
I mean, we all know the thing has been done, I just didn’t expect to find it on gutenberg.org in between John L. Hülshof (Reading Made Easy for Foreigners) and Alexander von Humboldt (A Sketch of the Physical Description of the Universe). You can’t get away from biology nowadays.
Math Corner
Before the brainteasers, I just want to note the discovery on September 6 of the 46th known Mersenne prime number, with value 237,156,667 – 1. This was an unusual event because the prime is out of sequence: a bigger Mersenne prime had been discovered in August, value 243,112,609 – 1. If you want to see these numbers in their full glory, there are links here. Be warned, though; the dang things have millions of digits.
[A Mersenne number is one that is equal to 2p – 1 for some prime number p. A Mersenne prime is a Mersenne number that is a prime number. Not all of them are: 211 – 1 factorizes as 23×89, so it's a Mersenne number but not a Mersenne prime. Nor, of course, is every prime a Mersenne prime: 5 is not.
There is a vast literature on Mersenne primes, with many neat results. Here is one of my own favorites: between any number and its double (say between one million and two million), how many primes p would you expect to find, on average, for which 2p – 1 is a Mersenne prime? Answer: eγ, where e is the famous base of natural logarithms 2.7182818284590452353… and γ is Euler's gamma 0.5772156649015328606…, about which Julian Havil wrote a very fine book. eγ works out to about 1.7810724179901979852… The actual number of p's between one million and two million is two, close to the expected value. Between two million and four million there are also two. Between four million and eight million, however, there is only one. The average for these three ranges is therefore 1.666…, which is even closer to the expected value.]
O.K., the brainteasers. Just a couple of tiny ones this month.
[1] Take some whole number of more than one digit; e.g. the three-digit number 183. First double your number: 366. Now reverse your number's digits: 381. What is the absolute difference of those last two numbers (i.e. the bigger minus the smaller)? It's 15. Question: How small can this difference be? Can it ever be zero? If so, find an instance. If not, explain why not.
[2] One of Jonah's Timewasters, posted a while ago, was Drifts. A reader tells me the scoring system goes as follows: "You get more points the more balls you pick up, with 1 point for 3 greens, 5 for four greens, 11 for five, 17 for six, 25 for seven, etc. (The next few terms, for eight, nine, ten, … greens, are: 33, 41, 51, 61, 73, 85, 97, 111, 125, 141, 157, 173, 191, 209, 229, 249, 269, 291, 313, 337, 361, 385, 411, …) Once you get past that inital jump of 4 points (from 1 point for 3 greens to 5 points for 4), the jumps in number of points go: 6, 6, 8, 8, 8, 10, 10, 12, 12, 12, 14, 14, 16, 16, 16, … Question: How many points do you get for n balls?
